WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133986 Gene Name  CJA14782
Sequence Name  ? CJA14782 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans F56C9.10. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14782a.1 CJA14782a.1   [unknown]
Transcript:CJA14782b.1 CJA14782b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14782a CJA14782a   [unknown]
CDS:CJA14782b CJA14782b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA14782, GTGGGCAGCTGATATGACTAGTTTCAATTATGGCTCAAGCCAAGCTCCAGCAGTTGCTGC, WBGene00133986   Expr1079683 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA02579, AGAAGTACACAATATCAAATTCGACGAGCCAGTGTCCGCCATCAACGTCTCCGATCAATT, WBGene00121783   Expr1090219 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region