WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134179 Gene Name  CJA14975
Sequence Name  ? CJA14975 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, RING-type; Zinc finger, RING/FYVE/PHD-type; and Zinc finger, C3HC4 type (RING finger). Is an ortholog of C. elegans C11H1.3. In C. elegans, C11H1.3 is involved in negative regulation of vulval development and protein localization to basolateral plasma membrane. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14975.1 CJA14975.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14975 CJA14975   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA14975, AAACTACGAAGACGATAGTGGCCTAGAATGTATAATTTGTTTGTCTGACATTCGCGACAC, WBGene00134179   Expr1083494 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region