WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00236794 Gene Name  CJA46585
Sequence Name  ? CJA46585 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Protein of unknown function (DUF1096) and Protein of unknown function DUF1096. Is an ortholog of C. elegans Y5H2A.4 and members of the C. elegans pqn and abu gene classes including pqn-91 and abu-5. In C. elegans, abu-1 is involved in endoplasmic reticulum unfolded protein response. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA46585.1 CJA46585.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA46585 CJA46585   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA23829, AAACGTGCCAACAACAATGTGCTCCACAATGCCAACAACAGGCTGCTCCCCAGTGCCAAC, WBGene00179401   Expr1073302 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region