WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134636 Gene Name  CJA15432
Sequence Name  ? CJA15432 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Uncharacterised protein family UPF0561. Is an ortholog of C. elegans M01E5.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15432b.1 CJA15432b.1   [unknown]
Transcript:CJA15432c.1 CJA15432c.1   [unknown]
Transcript:CJA15432a.1 CJA15432a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15432b CJA15432b   [unknown]
CDS:CJA15432a CJA15432a   [unknown]
CDS:CJA15432c CJA15432c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA15380, CGACAGAGAATAGAACGAACACATGCCACTGTAGATGATATTTGCCTTTCACTTGCCAAT, WBGene00134584   Expr1086896 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA15432, GTTTGGAGTGGCGGTCAATGAGCCACAGGTGCAGAGAGGAGGTGATGATTCAAATGACAG, WBGene00134636   Expr1080368 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region