WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030708 Gene Name  Cbr-pxl-1
Sequence Name  ? CBG09041 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: LIM domain and Zinc finger, LIM-type. Is an ortholog of C. elegans pxl-1. In C. elegans, pxl-1 is involved in muscle structure development; nematode larval development; and nematode pharyngeal pumping. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09041d.1 CBG09041d.1   [unknown]
Transcript:CBG09041c.1 CBG09041c.1   [unknown]
Transcript:CBG09041b.1 CBG09041b.1   [unknown]
Transcript:CBG09041a.1 CBG09041a.1   [unknown]
Transcript:CBG09041i.1 CBG09041i.1   [unknown]
Transcript:CBG09041h.1 CBG09041h.1   [unknown]
Transcript:CBG09041g.1 CBG09041g.1   [unknown]
Transcript:CBG09041f.1 CBG09041f.1   [unknown]
Transcript:CBG09041e.1 CBG09041e.1   [unknown]
 

Other

9 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09041h CBG09041h   [unknown]
CDS:CBG09041i CBG09041i   [unknown]
CDS:CBG09041f CBG09041f   [unknown]
CDS:CBG09041g CBG09041g   [unknown]
CDS:CBG09041d CBG09041d   [unknown]
CDS:CBG09041e CBG09041e   [unknown]
CDS:CBG09041b CBG09041b   [unknown]
CDS:CBG09041c CBG09041c   [unknown]
CDS:CBG09041a CBG09041a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-pxl-1, GGACGGAAGTTCCATCCGGAGCACTTTAGATGCTCATACTGTAATCATCAGCTAACGAAA, WBGene00030708   Expr1061096 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG09042, AGGTCGTGATGATTTTGGAGGAGATTCTTATGATCTTCAAAGAACTATGGAGTCTCAAAG, WBGene00030709   Expr1052174 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region