WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030906 Gene Name  CBG09298
Sequence Name  ? CBG09298 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: HAD superfamily; HAD hydrolase, subfamily IA; Phosphoglycolate phosphatase-like, domain 2; Haloacid dehalogenase-like hydrolase; Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal; and HAD-like superfamily. Is an ortholog of C. elegans C04E6.7. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09298.1 CBG09298.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09298 CBG09298   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG09298, AAAACCAGACCCCAGATTTTATCAAATCGCTTTGGATTGTGCAGATGTACAGCCAGAGGA, WBGene00030906   Expr1069120 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region