WormBase Gene ID
|
WBGene00135200 | Gene Name | Cjp-rme-1 |
| Sequence Name
|
CJA15996 | Organism | Caenorhabditis japonica |
| Automated Description | Is predicted to encode a protein with the following domains: EF-hand domain pair; Domain of unknown function DUF5600; Cytoskeletal-regulatory complex EF hand; Dynamin; EH domain-containing protein, N-terminal; EH domain; EH domain-containing protein 4; Dynamin family; Domain of unknown function (DUF5600); P-loop containing nucleoside triphosphate hydrolase; and N-terminal EH-domain containing protein. Is an ortholog of C. elegans rme-1. In C. elegans, rme-1 is involved in several processes, including endocytic recycling; lipid tube assembly involved in organelle fission; and necroptotic process. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA15996.1 | CJA15996.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-rme-1, CGGATATCTATCGGGACGAGTGGCCAAGGAGCACATGGTGAAGAGCAAATTACCAAATTC, WBGene00135200 | Expr1074626 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
