WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131884 Gene Name  CJA12680
Sequence Name  ? CJA12680 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FAD/NAD(P)-binding domain superfamily and FAD dependent oxidoreductase. Is an ortholog of C. elegans Y45G12B.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12680.1 CJA12680.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12680 CJA12680   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA12680, AAAGCTCGTCAAGAAGCACTTCTCTTTTGGCATCAGCGAGCTATATCGAGGAGTTTGGAT, WBGene00131884   Expr1073839 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA27013, CGGCAACGAGTTCTCTTGCCATCGCCAAAATGATCACTACTGAAGCCGTGAAAAGGTTTA, WBGene00182585   Expr1078806 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region