WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133962 Gene Name  Cjp-nol-6
Sequence Name  ? CJA14758 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Nrap protein domain 3; Nrap protein domain 6; Nrap protein, domain 6; Nrap protein PAP/OAS1-like domain 5; Nrap protein, domain 4; Nrap protein nucleotidyltransferase domain 4; Nrap protein, domain 5; NOL6/Upt22; Nrap protein domain 1; Nrap protein, domain 3; Nucleotidyltransferase superfamily; Nrap protein PAP/OAS-like domain; and Nrap protein, domain 2. Is an ortholog of C. elegans nol-6. In C. elegans, nol-6 is involved in negative regulation of innate immune response. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14758.1 CJA14758.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14758 CJA14758   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-nol-6, TCGGCGTAATGTTCAAACCACAAGAAGCGGAAGTACCCGCCAAAATCTCACGTTGCACTT, WBGene00133962   Expr1086257 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region