WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132113 Gene Name  Cjp-ubql-1
Sequence Name  ? CJA12909 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: UBA/TS-N domain; Heat shock chaperonin-binding; UBA-like superfamily; Ubiquitin-like domain; Ubiquitin-associated domain; Ubiquitin family; and Ubiquitin-like domain superfamily. Is an ortholog of C. elegans ubql-1. In C. elegans, ubql-1 is involved in ERAD pathway; negative regulation of double-strand break repair via homologous recombination; and protein export from nucleus. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12909.1 CJA12909.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12909 CJA12909   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA25009, AATCCCGAAGAGACGTACGCGTCGCAACTCGAGCAACTGCAATCGATGGGCTTCTCTAAC, WBGene00180581   Expr1074145 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA12909, ATTATGCGACAAACAATGGAAATGATTCGCAATCCCAACATGTTCCAGGAAATGATGCGA, WBGene00132113   Expr1076386 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA19517, TAAGTTTCGTGGAGCGCACTTGCTTTCGCCACGGATCGACAGTAATATCAGCACAAATAC, WBGene00175088   Expr1080125 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region