WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132036 Gene Name  Cjp-athp-2
Sequence Name  ? CJA12832 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: WSTF, HB1, Itc1p, MBD9 motif 1; Zinc finger, PHD-type; WSTF/Acf1/Cbp146; Bromodomain; WHIM1 domain; Bromodomain-like superfamily; Zinc finger, RING/FYVE/PHD-type; WHIM2 domain; Zinc finger, PHD-finger; ATP-utilising chromatin assembly and remodelling N-terminal; Zinc finger, FYVE/PHD-type; Williams-Beuren syndrome DDT (WSD), D-TOX E motif; DDT domain; and PHD-finger. Is an ortholog of C. elegans athp-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12832.1 CJA12832.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12832 CJA12832   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA06854, AAAAAGGAGGAGGAGGCAGAAGAGGGAGAAGGGGAGCAGAAGCCGAGTTGCAGTGACGTC, WBGene00126058   Expr1073011 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA12832, CAAATGGGACAAGAGTCGTTTGCAAGGAAAATGCCGAGCGTGCCGCCGAAAAGCTGCCGC, WBGene00132036   Expr1080900 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA14941, CAGCGAAATATACCAATTATCGCAGGAATTGAGTGAGTTTGCAGCGTCTCGTCTAGACGC, WBGene00134145   Expr1081624 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region