WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132506 Gene Name  Cjp-frm-8
Sequence Name  ? CJA13302 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: WW domain superfamily; PDZ superfamily; FERM/acyl-CoA-binding protein superfamily; FERM central domain; PDZ domain; WW domain; Band 4.1 domain; FERM superfamily, second domain; and Ubiquitin-like domain superfamily. Is an ortholog of C. elegans frm-8. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13302.1 CJA13302.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13302 CJA13302   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-frm-8, TACTCTGCCATCCATACAGTAATTAAATCAGACTGGAATTACACAGGAGACGACGTGACA, WBGene00132506   Expr1085378 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA25380, GGGTTTGTGGACGATTCTGCGGAAAGGGTGACGTTTTCGACGACGTTGGACGAGGAGAAT, WBGene00180952   Expr1084017 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26069, ATACGACGCGGAGACCAGGGTCACGGATATTCTGGAAAGCATCTGGGAAAAACTGCAAAT, WBGene00181641   Expr1081626 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region