WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133580 Gene Name  Cjp-crn-5
Sequence Name  ? CJA14376 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Exoribonuclease, phosphorolytic domain 1; Ribosomal protein S5 domain 2-type fold; PNPase/RNase PH domain superfamily; 3' exoribonuclease family, domain 1; and Exoribonuclease, PH domain 2 superfamily. Is an ortholog of C. elegans crn-5. In C. elegans, crn-5 is involved in RNA processing and apoptotic DNA fragmentation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14376.1 CJA14376.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14376 CJA14376   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-crn-5, GTTATGCGCAGCCATCGGCCAGAGCAATTTTCGATTTCTACAGAAATGTGATGCAGAGGA, WBGene00133580   Expr1091750 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region