WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133225 Gene Name  Cjp-lin-2
Sequence Name  ? CJA14021 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: PDZ superfamily; L27 domain; PDZ domain; P-loop containing nucleoside triphosphate hydrolase; Guanylate kinase; L27 domain, C-terminal; SH3 domain; Guanylate kinase/L-type calcium channel beta subunit; and SH3-like domain superfamily. Is an ortholog of C. elegans lin-2. In C. elegans, lin-2 is involved in several processes, including egg-laying behavior; positive regulation of vulval development; and protein localization to membrane. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14021.1 CJA14021.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14021 CJA14021   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-lin-2, ATCAAAAACACTCTCATTCACCGACATCCAAACAGATTTGCTTATCCTATTCCTCGTACG, WBGene00133225   Expr1091746 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region