WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130530 Gene Name  Cjp-coh-4
Sequence Name  ? CJA11326 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Conserved region of Rad21 / Rec8 like protein and Rad21/Rec8-like protein, C-terminal, eukaryotic. Is an ortholog of C. elegans coh-4. In C. elegans, coh-4 is involved in meiotic sister chromatid cohesion. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11326.1 CJA11326.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11326 CJA11326   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA11326, CGTCGAACTAGAGCCTATTGATCTGTCAAATATGAAGATTGTGATGACGCCGTTGAAAGA, WBGene00130530   Expr1088705 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region