WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130599 Gene Name  Cjp-sqv-7
Sequence Name  ? CJA11395 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Triose-phosphate Transporter family and Sugar phosphate transporter domain. Is an ortholog of C. elegans sqv-7. In C. elegans, sqv-7 is involved in several processes, including egg-laying behavior; proteoglycan biosynthetic process; and pyrimidine nucleotide-sugar transmembrane transport. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11395b.1 CJA11395b.1   [unknown]
Transcript:CJA11395a.1 CJA11395a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11395a CJA11395a   [unknown]
CDS:CJA11395b CJA11395b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-sqv-7, TATGCACACATCACAACTCTGCTCTGACCACCACGTGTGTCGGACCAATCAAGAATCTGT, WBGene00130599   Expr1074946 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region