WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029125 Gene Name  Cbr-sec-16A.1
Sequence Name  ? CBG06940 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: COPII coat assembly protein, Sec16; Sec16, central conserved domain; Sec23-binding domain of Sec16; Vesicle coat trafficking protein Sec16 mid-region; and Ancestral coatomer element 1, Sec16/Sec31. Is an ortholog of C. elegans sec-16A.1. In C. elegans, sec-16A.1 is involved in endoplasmic reticulum to Golgi vesicle-mediated transport and protein localization to endoplasmic reticulum exit site. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06940b.1 CBG06940b.1   [unknown]
Transcript:CBG06940a.1 CBG06940a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06940a CBG06940a   [unknown]
CDS:CBG06940b CBG06940b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG06940, TGTGGATCCGTTCAGTGCAGAAGCGAGTCCAACCGCAGAAGATGGATCAAAACAAAATTA, WBGene00029125   Expr1053499 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region