WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132120 Gene Name  CJA12916
Sequence Name  ? CJA12916 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srx and 7TM GPCR, serpentine receptor class x (Srx). Is an ortholog of C. elegans K01A12.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12916b.1 CJA12916b.1   [unknown]
Transcript:CJA12916a.1 CJA12916a.1   [unknown]
Transcript:CJA12916d.1 CJA12916d.1   [unknown]
Transcript:CJA12916c.1 CJA12916c.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12916b CJA12916b   [unknown]
CDS:CJA12916a CJA12916a   [unknown]
CDS:CJA12916d CJA12916d   [unknown]
CDS:CJA12916c CJA12916c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA12916, GTGTTGGATTTGGGGAGACAGACGGTGGAACACTGGGTCAAATTTGCTAAAAAGGCTAGT, WBGene00132120   Expr1080022 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region