Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG06418.1 | CBG06418.1 | [unknown] |
Other
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Feature : "ges-1.WGATAR" | Expr11335 | Multiple copies of either the individual or the paired Cb-ges-1 WGATAR sites, in either orientation and with either C. elegans or C. briggsae as transformation hosts, produce intense reporter gene expression specifically in the embryonic gut. In both host species, reporter expression was first observed at the 4E cell stage of development,the stage at which endogenous ges-1 expression normally can first be detected. Although these reporter constructs initiate expression atthe correct stage, expression is not maintained much laterthan the L2 larval stage in either species;in contrast, endogenous Ce-ges-1 expression continues toincrease throughout the life of the worm. When only a single copy of either the upstreamWGATAR site, the downstream WGATAR site, or thetandem pair of sites was inserted into the test vector andintroduced into C. elegans, no expression in transformedembryos could be detected, either within the gut or elsewhereand even with prolonged staining for b-galactosidaseactivity | ||
| Cbr-ges-1, AACAATTGATATTCTCAGATGGTCGCCGGTGATTGATGGAGATTATTTACCAAAGAATCC, WBGene00028697 | Expr1055141 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
