WormBase Gene ID
|
WBGene00065703 | Gene Name | Cre-eel-1 |
| Sequence Name
|
CRE29934 | Organism | Caenorhabditis remanei |
| Automated Description | Is predicted to encode a protein with the following domains: UBA/TS-N domain; Domain of Unknown Function (DUF913); UBA-like superfamily; HUWE1/Rev1, ubiquitin binding region; Ubiquitin binding region; Domain of Unknown Function (DUF908); Ubiquitin-associated domain; E3 ubiquitin ligase, domain of unknown function DUF908; and E3 ubiquitin ligase, domain of unknown function DUF913. Is an ortholog of C. elegans eel-1. In C. elegans, eel-1 is involved in several processes, including asymmetric protein localization involved in cell fate determination; hemidesmosome assembly; and signal transduction in response to DNA damage. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE29934.1 | CRE29934.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-eel-1, TGCTATCCTGACTCAATTCCCAAAACTTTTGGATTTCGATGTGAAGAGAAAATACTTCCG, WBGene00065703 | Expr1115207 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
