WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029191 Gene Name  Cbr-djr-1.1
Sequence Name  ? CBG07016 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Class I glutamine amidotransferase-like; DJ-1/PfpI; DJ-1/PfpI family; and Protein/nucleic acid deglycase DJ-1. Is an ortholog of C. elegans djr-1.1. In C. elegans, djr-1.1 is involved in several processes, including aldehyde metabolic process; cellular response to aldehyde; and monocarboxylic acid biosynthetic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07016.1 CBG07016.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07016 CBG07016   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-djr-1.1, TGAAGATTGTGGAGCTTCTAGAGGGAACTGAGAAGGCCAATAGCCTCATTGAACCAATGC, WBGene00029191   Expr1057648 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region