WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033347 Gene Name  CBG12391
Sequence Name  ? CBG12391 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: SHR-binding domain of vacuolar-sorting associated protein 13; Vacuolar sorting-associated protein 13, N-terminal; N-terminal region of Chorein or VPS13; VPS13, repeated coiled region; Vacuolar protein sorting-associated protein 13; Vacuolar-sorting-associated 13 protein C-terminal; Vacuolar protein sorting-associated protein 13, C-terminal; Vacuolar protein sorting-associated protein 13-like, N-terminal domain; Vacuolar protein sorting-associated protein 13, second N-terminal domain; Repeating coiled region of VPS13; and Vacuolar protein sorting-associated protein 13, SHR-binding domain. Is an ortholog of C. elegans T08G11.1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12391a.1 CBG12391a.1   [unknown]
Transcript:CBG12391b.1 CBG12391b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12391a CBG12391a   [unknown]
CDS:CBG12391b CBG12391b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG12391, GGAAGATTTGAACCGTAAACCACAATCGTTTGGAGAGGGAATGGCTCGTGGACTAAAAGG, WBGene00033347   Expr1068087 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region