WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00063085 Gene Name  Cre-aakb-2
Sequence Name  ? CRE01035 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: ASC domain superfamily; Immunoglobulin-like fold; Immunoglobulin E-set; 5'-AMP-activated protein kinase beta subunit, interaction domain; Glycogen recognition site of AMP-activated protein kinase; AMP-activated protein kinase, glycogen-binding domain; and Association with the SNF1 complex (ASC) domain. Is an ortholog of C. elegans aakb-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE01035.1 CRE01035.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE01035 CRE01035   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-aakb-2, ACAATATGATAAACATCCAAGACTCGGATTTTGCAGTCTTCGAGGCTCTTGATGAAGACT, WBGene00063085   Expr1104848 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region