WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00063442 Gene Name  CRE03026
Sequence Name  ? CRE03026 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Interactor of ZYG-11 and Protein of unknown function DUF856, Caenorhabditis species. Is an ortholog of C. elegans Y69E1A.1; Y37D8A.5; and W03D8.9. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE03026.1 CRE03026.1   [unknown]
Transcript:CRE03026.2 CRE03026.2   [unknown]
Transcript:CRE03026.3 CRE03026.3   [unknown]
Transcript:CRE03026.4 CRE03026.4   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE03026 CRE03026   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE03026, CTCTTACTTCTTGTTGGCTGCTCTCTACAGTGGAGCTTCTGGAGCACTCCTTCAGATTGC, WBGene00063442   Expr1100288 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region