WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060923 Gene Name  Cre-aspm-1
Sequence Name  ? CRE20768 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Abnormal spindle-like microcephaly-associated protein; IQ calmodulin-binding motif; CH domain superfamily; Calponin homology domain; IQ motif, EF-hand binding site; and Calponin homology (CH) domain. Is an ortholog of C. elegans aspm-1. In C. elegans, aspm-1 is involved in establishment of meiotic spindle orientation; meiotic spindle organization; and regulation of protein localization. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20768.1 CRE20768.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20768 CRE20768   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-aspm-1, ACTTCGTAATTGTACTGTTTATGGACTCGTTAACGACAATCTTCATATCGTTCATTTAGC, WBGene00060923   Expr1109477 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region