WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128387 Gene Name  Cjp-rad-54.L.2
Sequence Name  ? CJA09183 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Helicase, C-terminal; P-loop containing nucleoside triphosphate hydrolase; and Helicase conserved C-terminal domain. Is an ortholog of C. elegans rad-54.L. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09183.1 CJA09183.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09183 CJA09183   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28582, TCCGGCTCGACGGCTCAATGTCAATTAAACAACGCTCGAAAATTGTGGACACTTTTAACG, WBGene00184156   Expr1077650 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-rad-54, AACGGCTGACTGCGCAAGTGACCTCTCGAATTGGTTTCATTCGCAGAAAAGTGCCAGAAA, WBGene00128387   Expr1089959 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region