WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00061748 Gene Name  CRE20350
Sequence Name  ? CRE20350 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: RecF/RecN/SMC, N-terminal; P-loop containing nucleoside triphosphate hydrolase; and RecF/RecN/SMC N terminal domain. Is an ortholog of C. elegans smc-4. In C. elegans, smc-4 is involved in mitotic sister chromatid segregation and positive regulation of nematode male tail tip morphogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20350.1 CRE20350.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20350 CRE20350   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE20350, GAAGGACGTGTGAGGAAGCAATTAAATCATACAGCCAGTGACACAACTTCTGGGTCGAGG, WBGene00061748   Expr1093791 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region