WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129767 Gene Name  Cjp-lad-2
Sequence Name  ? CJA10563 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Fibronectin type III superfamily; Fibronectin type III domain; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin-like domain superfamily; Basigin-like; and Fibronectin type III. Is an ortholog of C. elegans lad-2. In C. elegans, lad-2 is involved in anterior/posterior axon guidance; dorsal/ventral axon guidance; and regulation of axon guidance. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10563.1 CJA10563.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10563 CJA10563   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-lad-2, TTTTACACGAGTTAGCAGAAGATTCTCGGAGAGTTTTATTGGATCATGGGCGGATTTTAA, WBGene00181738   Expr1081987 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA10563, CGAAATTGGCCATCAGAAGGACAACGAGGAAGAGAAGCAGTTTCTCGAGTATCAGTACGG, WBGene00129767   Expr1088691 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region