WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062514 Gene Name  Cre-kdin-1
Sequence Name  ? CRE12558 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: KAP family P-loop domain; Ankyrin repeats (3 copies); Ankyrin repeat-containing domain superfamily; Ankyrin repeats (many copies); Ankyrin repeat; and Domain of unknown function DUF3447. Is an ortholog of C. elegans kdin-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE12558.1 CRE12558.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE12558 CRE12558   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-tag-144, ATAAATTGAATCTATGTGGTCTTGTTCTTGCCACTTGTCCACTTCCAGAGCTTAAGGAAA, WBGene00062514   Expr1100675 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE20657, AAAATGGACACGGCGATGGGATATGATGTTTATTCGAATGTTTTAGCTGATATTGGTTAG, WBGene00081238   Expr1101726 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region