WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062701 Gene Name  CRE10143
Sequence Name  ? CRE10143 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Spermadhesin, CUB domain superfamily and CUB-like domain. Is an ortholog of C. elegans K08D8.4 and irg-6. In C. elegans, irg-6 is involved in response to gamma radiation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE10143.1 CRE10143.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE10143 CRE10143   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE10143, CCCAATGGAAGTCAAGACATCTCTGAAAATCTATCACTTGGATACTGGAAGACTTTCTCT, WBGene00062701   Expr1092724 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE13166, TGAGCCGTATTACTATCCTGAAGGATGGAGAGAAGGAATGGAGCCAGCTAAATATGCAGG, WBGene00075207   Expr1109082 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region