WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062690 Gene Name  CRE10326
Sequence Name  ? CRE10326 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: FERM C-terminal PH-like domain; Ubiquitin-like domain superfamily; FERM/acyl-CoA-binding protein superfamily; FERM central domain; Band 4.1 domain; FERM superfamily, second domain; and FERM, C-terminal PH-like domain. Is an ortholog of C. elegans F07C6.4. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE10326.1 CRE10326.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE10326 CRE10326   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE10326, GCTTGATGGCTCGGTTATTCTATACGACCTGGTCGCGTCAACTTCAAATCCAAAGGGCAC, WBGene00062690   Expr1097419 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region