WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062182 Gene Name  Cre-mtm-9
Sequence Name  ? CRE18844 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Myotubularin-like phosphatase domain; Protein-tyrosine phosphatase-like; Myotubularin family; and PH-like domain superfamily. Is an ortholog of C. elegans mtm-9. In C. elegans, mtm-9 is involved in pinocytosis and regulation of cell migration. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE18844.1 CRE18844.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE18844 CRE18844   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-mtm-9, TATATATAGTGAAGGATTAAAAGAGGTTCCTGTGGTAATTCATGGAGGAGATGGTCTCGA, WBGene00062182   Expr1110722 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region