WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062250 Gene Name  Cre-lin-7
Sequence Name  ? CRE24909 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Protein lin-7; PDZ superfamily; L27 domain; PDZ domain; L27 domain, C-terminal; and L27 domain superfamily. Is an ortholog of C. elegans lin-7. In C. elegans, lin-7 is involved in several processes, including egg-laying behavior; positive regulation of vulval development; and protein localization to basolateral plasma membrane. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE24909.1 CRE24909.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE24909 CRE24909   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-lin-7, AGTCGTCCGTTATATGCCTAAATTACTCGATGAAATGGAGAGAAGATTCGAGAGACAACG, WBGene00062250   Expr1106586 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region