WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126297 Gene Name  CJA07093
Sequence Name  ? CJA07093 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Low-density lipoprotein receptor domain class A; CUB domain; Low-density lipoprotein (LDL) receptor class A repeat; Spermadhesin, CUB domain superfamily; and LDL receptor-like superfamily. Is an ortholog of C. elegans sol-2. In C. elegans, sol-2 is involved in several processes, including hyperosmotic response; positive regulation of glutamatergic synaptic transmission; and thigmotaxis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07093b.1 CJA07093b.1   [unknown]
Transcript:CJA07093a.1 CJA07093a.1   [unknown]
Transcript:CJA07093a.2 CJA07093a.2   [unknown]
Transcript:CJA07093a.3 CJA07093a.3   [unknown]
Transcript:CJA07093a.4 CJA07093a.4   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07093a CJA07093a   [unknown]
CDS:CJA07093b CJA07093b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07093, GATAGGAGAGGAGCGAATTGGTTTCAAAATTATCTGGACTGCAGTGGAAGGGCTTATTGG, WBGene00126297   Expr1086431 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region