WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126001 Gene Name  Cjp-sdpn-1
Sequence Name  ? CJA06797 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: AH/BAR domain superfamily; Fes/CIP4, and EFC/F-BAR homology domain; SH3-like domain superfamily; SH3 domain; FCH domain; and Variant SH3 domain. Is an ortholog of C. elegans sdpn-1. In C. elegans, sdpn-1 is involved in endocytic recycling. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06797.1 CJA06797.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06797 CJA06797   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-sdpn-1, GGGGATGAGATAGCGTTGAGAAAAGGGGAAATGATAGAAGTGCTCACAGAGCCAGACTCG, WBGene00126001   Expr1073078 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region