WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126725 Gene Name  Cjp-unc-89
Sequence Name  ? CJA07521 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Homeobox-like domain superfamily; RCSD; Immunoglobulin I-set; Immunoglobulin subtype 2; Immunoglobulin subtype; Immunoglobulin-like fold; RCSD region; Immunoglobulin I-set domain; Immunoglobulin V-set domain; Immunoglobulin-like domain superfamily; and Winged helix-like DNA-binding domain superfamily. Is an ortholog of C. elegans unc-89. In C. elegans, unc-89 is involved in several processes, including myofibril assembly; nematode pharyngeal gland morphogenesis; and regulation of striated muscle contraction. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07521a.1 CJA07521a.1   [unknown]
Transcript:CJA07521b.1 CJA07521b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07521a CJA07521a   [unknown]
CDS:CJA07521b CJA07521b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-unc-89, CAAGGCACCAAAAGTTATCGAGCCACTGGAGAACGTGCGAATCCCCGAGAAGCAAGGATT, WBGene00126725   Expr1076076 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region