WormBase Gene ID
|
WBGene00126967 | Gene Name | Cjp-syg-2 |
| Sequence Name
|
CJA07763 | Organism | Caenorhabditis japonica |
| Automated Description | Is predicted to encode a protein with the following domains: Immunoglobulin; Immunoglobulin domain; Immunoglobulin I-set; Immunoglobulin subtype 2; Fibronectin type III domain; Immunoglobulin subtype; Fibronectin type III; Immunoglobulin-like fold; Immunoglobulin I-set domain; Fibronectin type III superfamily; Immunoglobulin-like domain superfamily; CD80-like C2-set immunoglobulin domain; and CD80-like, immunoglobulin C2-set. Is an ortholog of C. elegans syg-2. In C. elegans, syg-2 is involved in several processes, including cell-cell adhesion; nervous system development; and protein localization to synapse. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA07763.1 | CJA07763.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-syg-2, CGTGCTGCAATCGGAGACATACGGCAAGTTCAGATGTACGGAGCATTACTGACAAATGAA, WBGene00126967 | Expr1076727 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
