WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127098 Gene Name  CJA07894
Sequence Name  ? CJA07894 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: RNase H-like domain found in reverse transcriptase; Reverse transcriptase/Diguanylate cyclase domain; DNA/RNA polymerase superfamily; Reverse transcriptase/retrotransposon-derived protein, RNase H-like domain; DNA2/NAM7 helicase-like, C-terminal; P-loop containing nucleoside triphosphate hydrolase; Reverse transcriptase (RNA-dependent DNA polymerase); AAA domain; and Reverse transcriptase domain. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07894a.1 CJA07894a.1   [unknown]
Transcript:CJA07894b.1 CJA07894b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07894a CJA07894a   [unknown]
CDS:CJA07894b CJA07894b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA25363, GTGTAAATTTATCAAATCTCAAATTCCGAGATGCGCTGTGGCCACCTTGTGCCACTCCTT, WBGene00180935   Expr1089095 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA13078, GTCTCAAATGATGCAGGTATTATTCAAGTAGTAGCTTACGGAAGCAGGACTCTCTCCGAG, WBGene00132282   Expr1082783 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region