WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127594 Gene Name  Cjp-agxt-1
Sequence Name  ? CJA08390 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Pyridoxal phosphate-dependent transferase; Pyridoxal phosphate-dependent transferase, small domain; Aminotransferase class V domain; Serine-pyruvate aminotransferase/2-aminoethylphosphonate-pyruvate transaminase; Pyridoxal phosphate-dependent transferase, major domain; and Aminotransferase class-V. Is an ortholog of C. elegans agxt-1. In C. elegans, agxt-1 is involved in glycine biosynthetic process, by transamination of glyoxylate. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08390.1 CJA08390.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08390 CJA08390   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA08390, AAAAGATCCGGAATAGAAAACAACGCGTCGCCTCGTTCTATTTTGACGCACTCGAATTGG, WBGene00127594   Expr1089619 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region