WormBase Gene ID
|
WBGene00124639 | Gene Name | Cjp-sem-5 |
| Sequence Name
|
CJA05435 | Organism | Caenorhabditis japonica |
| Automated Description | Is predicted to encode a protein with the following domains: SH3 domain; Grb2-like; SH2 domain superfamily; SH3-like domain superfamily; Variant SH3 domain; and SH2 domain. Is an ortholog of C. elegans sem-5. In C. elegans, sem-5 is involved in several processes, including epidermal growth factor receptor signaling pathway; male genitalia development; and regulation of vulval development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA05435.1 | CJA05435.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-sem-5, GCATCTTCCCTTCCAACTACGTGTGTCCCTACAATAGTACCACGAAAAGCAACACAAACG, WBGene00124639 | Expr1081337 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
