WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124816 Gene Name  Cjp-gap-3
Sequence Name  ? CJA05612 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Rho GTPase activation protein; SH2 domain superfamily; and SH3-like domain superfamily. Is an ortholog of C. elegans gap-3. In C. elegans, gap-3 is involved in chemosensory behavior; learning or memory; and negative regulation of MAPK cascade. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05612b.1 CJA05612b.1   [unknown]
Transcript:CJA05612a.1 CJA05612a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05612a CJA05612a   [unknown]
CDS:CJA05612b CJA05612b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28116, CGGCCACTCTGATGGCTCAAATGAGCAGCAGCCAGTATGATGATGTGAGGAATAAGGAAA, WBGene00183690   Expr1088491 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-gap-3, AATTCGAATTCGAAGAGAAGCCATTGCCAGAAGGCGAATTACACACCGAATGGCTCGCTT, WBGene00124816   Expr1076742 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region