WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124018 Gene Name  Cjp-dlg-1
Sequence Name  ? CJA04815 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: L27-1; PDZ superfamily; L27 domain; L27_1; PDZ domain; P-loop containing nucleoside triphosphate hydrolase; Guanylate kinase; SH3-like domain superfamily; SH3 domain; Guanylate kinase/L-type calcium channel beta subunit; and L27 domain superfamily. Is an ortholog of C. elegans dlg-1. In C. elegans, dlg-1 is involved in embryo development and zonula adherens assembly. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04815.1 CJA04815.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04815 CJA04815   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-dlg-1, GATGAGCGAAGATGAAGCTCACGCCCAGTTTTCGAGATGCCAGAGAATTGAGCAAGCTTT, WBGene00124018   Expr1070475 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region