WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124309 Gene Name  CJA05105
Sequence Name  ? CJA05105 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: LDL receptor-like superfamily; Low-density lipoprotein receptor domain class A; Low-density lipoprotein (LDL) receptor class A repeat; and Low-density lipoprotein receptor-related protein 11. Is an ortholog of C. elegans Y34D9A.8. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05105a.1 CJA05105a.1   [unknown]
Transcript:CJA05105c.1 CJA05105c.1   [unknown]
Transcript:CJA05105b.1 CJA05105b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05105a CJA05105a   [unknown]
CDS:CJA05105b CJA05105b   [unknown]
CDS:CJA05105c CJA05105c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA05105, CCACAATCTTTTGCAACAGGATTCTGATGAGGACGATATTTTGATAAGTTCCATGTATTC, WBGene00124309   Expr1071584 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26183, GAAACGGAGAATGCATTGCTCATTACGACGTTTGCGACGGAATTCAGCAGTGTACCGACG, WBGene00181755   Expr1076587 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region