WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124381 Gene Name  CJA05177
Sequence Name  ? CJA05177 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: AAA domain; DNA2/NAM7 helicase-like, C-terminal; and P-loop containing nucleoside triphosphate hydrolase. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05177.1 CJA05177.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05177 CJA05177   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA05177, GCCAAGAAGATAATGGTTGTCATCGTGAACCACGAAGCCGCCAGTCAGCGAAAACCATGG, WBGene00124381   Expr1084764 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA08119, AGAATTCGAACCCGTTCAGAAAGGCAAAGTCATCAGAGCGATCCACAAAACCCGCATCCT, WBGene00127323   Expr1090975 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region