WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129528 Gene Name  CJA10324
Sequence Name  ? CJA10324 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Protein of unknown function DUF829, TMEM53 and Eukaryotic protein of unknown function (DUF829). Is an ortholog of C. elegans T10B11.5. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10324.1 CJA10324.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10324 CJA10324   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28986, CTTGGATGGGCGGGAGCCACCGATCGTAATGTTGCGAAATACGCGGAAATATACAGTAAA, WBGene00184560   Expr1082961 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA10324, AGAAGCTGTTTCACCGTATCACTATATCCTAAATCATCCGAATCTACCACCAGTTATCAC, WBGene00129528   Expr1073603 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region