WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125539 Gene Name  Cjp-par-5
Sequence Name  ? CJA06335 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: 14-3-3 protein; 14-3-3 domain superfamily; and 14-3-3 domain. Is an ortholog of C. elegans par-5. In C. elegans, par-5 is involved in several processes, including cell fate commitment; determination of adult lifespan; and establishment of localization in cell. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06335.2 CJA06335.2   [unknown]
Transcript:CJA06335.1 CJA06335.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06335 CJA06335   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-par-5, ACATCTGACGTTGTGGGAGATGATCAGGAGCAAGAAGGAAACGCTGATGCCGGAAATTAA, WBGene00125539   Expr1082160 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region