WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123250 Gene Name  Cjp-lin-38
Sequence Name  ? CJA04046 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Homeobox-like domain superfamily. Is an ortholog of C. elegans lin-38. In C. elegans, lin-38 is involved in negative regulation of vulval development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04046a.1 CJA04046a.1   [unknown]
Transcript:CJA04046c.1 CJA04046c.1   [unknown]
Transcript:CJA04046b.1 CJA04046b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04046a CJA04046a   [unknown]
CDS:CJA04046b CJA04046b   [unknown]
CDS:CJA04046c CJA04046c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA04046, CGTCTTCACCAACAGGAGACGCGGAATCCGAGTGCGAAACAAGTTATTCGAACGGAAAAT, WBGene00123250   Expr1079961 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26970, GCCAGTATGATCCCGACCGCTGAGACAGAAGTTGTAATGTCAGGAGATGGAATTCAGAAT, WBGene00182542   Expr1078230 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region