WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123327 Gene Name  CJA04124
Sequence Name  ? CJA04124 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans B0041.5. In C. elegans, B0041.5 is involved in regulation of lipid storage and regulation of peptide transport. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04124b.1 CJA04124b.1   [unknown]
Transcript:CJA04124a.1 CJA04124a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04124a CJA04124a   [unknown]
CDS:CJA04124b CJA04124b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA04124, GCTTCAATCCGAGCGAGGTGGAGGTGTGTAAATGCGAGTATTGTGCGACGATGATTATGT, WBGene00123327   Expr1076497 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA11884, CAAATACTCGCCTCTATACCCATTTTACTAGCATTTGTAGGCGCCGCCTACGCCCAAAAC, WBGene00131088   Expr1090226 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region