WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120054 Gene Name  CJA00850
Sequence Name  ? CJA00850 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Alpha/beta knot methyltransferases; Putative RNA methyltransferase; tRNA (guanine-N1-)-methyltransferase, N-terminal; and Nucleic acid-binding, OB-fold. Is an ortholog of C. elegans B0361.6. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00850.1 CJA00850.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00850 CJA00850   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28092, AGAATGTGCTCTCAGTGCTCGCACAAGTTCAGTGTCGGCTTGAAACTCTTAATCAGCTTT, WBGene00183666   Expr1087677 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00850, GCTGGAGTGTCGCCACGTGGAAAACTTGCTTCTCAAATGGATGTTTGCATTCTGAACAAA, WBGene00120054   Expr1086845 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region