WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137894 Gene Name  Cjp-lst-6
Sequence Name  ? CJA18691 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: dDENN domain; RUN domain superfamily; DENN (AEX-3) domain; DENN domain, C-terminal lobe; cDENN domain; and uDENN domain. Is an ortholog of C. elegans lst-6. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18691b.1 CJA18691b.1   [unknown]
Transcript:CJA18691a.1 CJA18691a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18691a CJA18691a   [unknown]
CDS:CJA18691b CJA18691b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA18691, AAAAGAATGCTGGTCGACAAAATGGGCAAAGAAGCGGTCCAACTCGGACACCTCGACGCC, WBGene00137894   Expr1072349 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00072, TTGCCACGAAATCGAAGAGATCGCACGAAACGAGTGTCTTATTATGAAGGAGGCGGAAGC, WBGene00119278   Expr1071172 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region